View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_low_13 (Length: 310)
Name: NF0707_1D_low_13
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_1D_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 298
Target Start/End: Original strand, 9546316 - 9546616
Alignment:
Q |
1 |
cgtcttcttcttggtcttcatcttcttcgacttgttgttgttcatactgatcatcttgatgttgttgatcatgacgttgtgtatgagttttccatatgtt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
9546316 |
cgtcttcttcttggtcttcatcttcttcgacttgttgttgttcatactgatcatcttgatgctgttgatcatgacgttgtgtatgagttttccatatgtt |
9546415 |
T |
 |
Q |
101 |
gttatcttcgcgagacaatgatatgagnnnnnnngctacttcttcttcagttgttatatccgatgaagaactcagtacagaaacagactcattctgtact |
200 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
T |
9546416 |
gttatcttcgcgagacaatgatatgagaaaaaaagctacttcttcttcagttgttatatccgatgaagaactcagtacagaaaaagactcgttctgtact |
9546515 |
T |
 |
Q |
201 |
gagtttttcaccggatc---atctttcttgacccgtttggatcgtggaccagttggattctttgatgattcagtttcactttctctatcttcctgaagaa |
297 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||| |||||||||||||||||| |
|
|
T |
9546516 |
gagtttttcaccggatcattatctttcttgacccgtttggatcgtggtccagttggattctttgacgactcagtttcacttcctctatcttcctgaagaa |
9546615 |
T |
 |
Q |
298 |
t |
298 |
Q |
|
|
| |
|
|
T |
9546616 |
t |
9546616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University