View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_low_22 (Length: 271)
Name: NF0707_1D_low_22
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_1D_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 265
Target Start/End: Complemental strand, 52542503 - 52542245
Alignment:
| Q |
7 |
ttggtgttcttaatgaagactcttttcgaaagaatttcgtccttgtttatgaacttcttgatgaagtcattgtaagtactttttaccttggttcaaggtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52542503 |
ttggtgttcttaatgaagactcttttcgaaagaatttcgtccttgtttatgaacttcttgatgaagtcattgtaagtactttttaccttggttcaaggtt |
52542404 |
T |
|
| Q |
107 |
tgcatgtcaagtataacccatttagtgcagcaagatacactgttcagaataaaatgctgtcgagtagttgctttagcgttgcggaattagaacatactgc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
52542403 |
tgcatgtcaagtataacccatttagtgcagcaagatacactgttcagaataaaatgctgtcgagtagttactttagcgtagcggaattagaacatactgc |
52542304 |
T |
|
| Q |
207 |
tattttccgcaaactgcgaatgataacnnnnnnnctgtttgatagatatgtgtacttgt |
265 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52542303 |
tattttccgcaaactgcgaatgataactttgtttctgtttgatagatatgtgtacttgt |
52542245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1432 times since January 2019
Visitors: 4416