View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_low_29 (Length: 245)
Name: NF0707_1D_low_29
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_1D_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 53127520 - 53127325
Alignment:
| Q |
16 |
cttagataaatttaccgtgtatttctaaagctgtaattaagttattttattagcgtaataatcgataatgtacttgaaaataatttggaatttcctccat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53127520 |
cttagataaatttaccgtgtatttctaaagctgtaattaagttattttattagcgtaataatcgataatgtacttgaaaataatttggaatttcctccat |
53127421 |
T |
|
| Q |
116 |
tttcagctgacgaaattagaatgggacaaaacaagtttgtagtaattgggacggtggcggaacagaggttagttgagcaacccacccgtcacgcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53127420 |
tttcagctgacgaaattagaatgggacaaaacaagtttgtagtaattgggacggtggcggaacagaggttagttgagcaacccacccgtcacgcaa |
53127325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1046 times since January 2019
Visitors: 4402