View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_low_30 (Length: 241)
Name: NF0707_1D_low_30
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_1D_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 24 - 241
Target Start/End: Complemental strand, 9526839 - 9526622
Alignment:
| Q |
24 |
tagatacctcatagaagtacaaatataaaaagtataccgataacatttgatcatttaccaatgacatgttattgacatttaatcttttaagtatgtggtc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
9526839 |
tagatacctcatagaagtacaaatataaaaagtataccgataacatttgatcatttaccaatgacatattattgacatttaatcttttaagtatgtagtc |
9526740 |
T |
 |
| Q |
124 |
aaatgttcgatacttaggtttataaagaaccaaaaatgttgggagagatcggcatcttaaataaatatcagttatatcgtagaattagtctctgtagttg |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9526739 |
aaatgttcgatacttaagtttataaagaaccaaaaatgttgggagagatcggcatcttaaataaatatcagttatatcgtagaattagtctctgtagttg |
9526640 |
T |
 |
| Q |
224 |
tatacggaatctgccccg |
241 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9526639 |
tatacggaatctgccccg |
9526622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University