View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_low_37 (Length: 225)
Name: NF0707_1D_low_37
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_1D_low_37 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 11571040 - 11570819
Alignment:
| Q |
2 |
gacatcaggtggattctccttggtatgatcaatgaagtgttgagagtctgaaagttgtttgatagatctcttgaacttgatagtctccaatgccttctta |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11571040 |
gacagcaggtggattctccttggtatgatcaatgaagtgttgagagtctgaaagttgtttgatagatctcttgaacttgatagtctccaatgccttctta |
11570941 |
T |
 |
| Q |
102 |
ttttccgtaaggacttctaacaacttttcttcttgcatcctggttaaggtattgcttattatggaagggtgacgacgatcttcacctaaaaagacgtaat |
201 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11570940 |
ttttccgtaaggacttctaacaacctt--ttcttgcatcctggttaaggtattgcttattatggaagggtgacgatgatcttcacctaaaaagacgtaat |
11570843 |
T |
 |
| Q |
202 |
taaaatgttaaggaagtttcttaa |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11570842 |
taaaatgttaaggaagtttcttaa |
11570819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 78
Target Start/End: Original strand, 15553342 - 15553396
Alignment:
| Q |
24 |
gtatgatcaatgaagtgttgagagtctgaaagttgtttgatagatctcttgaact |
78 |
Q |
| |
|
|||||||||||||||||| |||||||| | | ||||||||| ||||| ||||||| |
|
|
| T |
15553342 |
gtatgatcaatgaagtgtggagagtctaacaattgtttgattgatcttttgaact |
15553396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University