View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_1D_low_41 (Length: 220)
Name: NF0707_1D_low_41
Description: NF0707_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_1D_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 3698854 - 3699057
Alignment:
| Q |
10 |
tgagatggacatcaaggggtaaataactcattatccttgttagtttgctatagtttgaaatatggttgttac----aatgaagagaatagtaacagtaga |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
3698854 |
tgagatggacaccaaggggtaaataactcattatccttgttagtttgctatagtttacaatacggttgttaccagcaatgaagagaatagtaacagtaga |
3698953 |
T |
 |
| Q |
106 |
attagtctaagccgcaactcaaattgaaaagctattttaatgttcacttgtagttttttaacaacatttgtttagcagttgttcatgctattatgcatcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3698954 |
attagtctaagccgcaactcaaattgaaaagctattttaatgttcacttgtaattttttaacaacatttgtttagcagttgttcatgctattctgcatct |
3699053 |
T |
 |
| Q |
206 |
gtgt |
209 |
Q |
| |
|
|||| |
|
|
| T |
3699054 |
gtgt |
3699057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 3703777 - 3703822
Alignment:
| Q |
175 |
gtttagcagttgttcatgctattatgcatccgtgtgttttatttat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3703777 |
gtttagcagttgttcatgctattatgcatccgtgtgttttatttat |
3703822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University