View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_high_20 (Length: 220)
Name: NF0707_2D_high_20
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_2D_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 32369025 - 32369213
Alignment:
Q |
18 |
agaatcttcggtctcgcagcggatgctacttgcttgtgctgtctcattgatcttgttgctatttgctactccnnnnnnnnnnnnnnnnnnnncagtgaac |
117 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
32369025 |
agaatcttcggtctcgcagcagatgctacttgcttgtgctgtctcattgatcttgttgctatttgctactccagagagagagagagagagagcagtgaac |
32369124 |
T |
 |
Q |
118 |
gacgacgtttttggctctgatgtgaacaacttcgactttgcttctggtgatgatggaatggaagcgcaactatcacgctgttacaccttgca |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32369125 |
gacgacgtttttggctctgatgtgaacaacttcgactttgcttctgg---tgatggaatggaagcgcaactatcacgctgttacaccttgca |
32369213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University