View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_2D_high_22 (Length: 215)

Name: NF0707_2D_high_22
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_2D_high_22
NF0707_2D_high_22
[»] chr1 (3 HSPs)
chr1 (79-197)||(7166946-7167064)
chr1 (81-185)||(7160310-7160414)
chr1 (7-58)||(7166871-7166922)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 79 - 197
Target Start/End: Original strand, 7166946 - 7167064
Alignment:
79 ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7166946 ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa 7167045  T
179 cagtttcggccatagaacc 197  Q
    |||||||||||||||||||    
7167046 cagtttcggccatagaacc 7167064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 81 - 185
Target Start/End: Original strand, 7160310 - 7160414
Alignment:
81 acctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaaca 180  Q
    |||||||||||| || || ||||||||  |||| |||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||     
7160310 acctgggtcgcgcacggtggctcgaactgtgtagccgcgctccataagtctcataacaagccacgacccgatgaaacctgaagcccctgtgacgcaaact 7160409  T
181 gtttc 185  Q
    |||||    
7160410 gtttc 7160414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 7166871 - 7166922
Alignment:
7 tggtgttaaaatatgaattgatttatacatgatatgaaaaatgttgcaacat 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
7166871 tggtgttaaaatatgaattgatttatacatgatatgaaaaatgttgcaacat 7166922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University