View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_2D_high_23 (Length: 213)

Name: NF0707_2D_high_23
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_2D_high_23
NF0707_2D_high_23
[»] chr1 (2 HSPs)
chr1 (58-200)||(13871754-13871896)
chr1 (1-64)||(13871929-13871992)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 58 - 200
Target Start/End: Complemental strand, 13871896 - 13871754
Alignment:
58 acatgagtctaactttgtttttcgttttgtggcggtgctttatgtttttgatctggtccaattggagttcaaaatgatgaattgtgtcacattcaacccg 157  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
13871896 acatgagtctaactttgtttttcgttttgtggcggtgcttcatgtttttgatctggtccaattggagtttgaaatgatgaattgtgtcacattcaacccg 13871797  T
158 ttaggatttcccttcacttcgtgtttgtggtggtgatgtccat 200  Q
    ||||| |||||||||||||| |||||||||||||| |||||||    
13871796 ttagggtttcccttcacttcatgtttgtggtggtggtgtccat 13871754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 13871929 - 13871992
Alignment:
1 aactaccctgtctagggttcactggtggtgcaacagagaacgtgtgcaccaccgacaacatgag 64  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||    
13871929 aactaccctgtctagggttcactggtggtgcaatagagaacgtgtgcaccaccgacagcatgag 13871992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University