View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_high_23 (Length: 213)
Name: NF0707_2D_high_23
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_2D_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 58 - 200
Target Start/End: Complemental strand, 13871896 - 13871754
Alignment:
| Q |
58 |
acatgagtctaactttgtttttcgttttgtggcggtgctttatgtttttgatctggtccaattggagttcaaaatgatgaattgtgtcacattcaacccg |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13871896 |
acatgagtctaactttgtttttcgttttgtggcggtgcttcatgtttttgatctggtccaattggagtttgaaatgatgaattgtgtcacattcaacccg |
13871797 |
T |
 |
| Q |
158 |
ttaggatttcccttcacttcgtgtttgtggtggtgatgtccat |
200 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13871796 |
ttagggtttcccttcacttcatgtttgtggtggtggtgtccat |
13871754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 13871929 - 13871992
Alignment:
| Q |
1 |
aactaccctgtctagggttcactggtggtgcaacagagaacgtgtgcaccaccgacaacatgag |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
13871929 |
aactaccctgtctagggttcactggtggtgcaatagagaacgtgtgcaccaccgacagcatgag |
13871992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University