View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_2D_high_24 (Length: 201)

Name: NF0707_2D_high_24
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_2D_high_24
NF0707_2D_high_24
[»] chr4 (1 HSPs)
chr4 (1-183)||(43985604-43985786)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 43985786 - 43985604
Alignment:
1 gattgaagttggaactgtgccaccactgttggatcttttagctacggaggataaaaccactcaggagaatgcaatctctgctttactgaagctttcaaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43985786 gattgaagttggaactgtgccaccactgttggatcttttagctacggaggataaaaccactcaggagaatgcaatctctgctttactgaagctttcaaag 43985687  T
101 tatgcaaccgggcctgaaaatataatagaccataacggtttaaatcccgttgtgtatgtactgaaaaatggacttagtcttga 183  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
43985686 tatgcaaccgggcctgaaaatataatagaccataacggtttaaagcccgttgtgtatgtactgaaaaatggacttagtcttga 43985604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University