View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_38 (Length: 257)
Name: NF0707_2D_low_38
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_2D_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 98 - 254
Target Start/End: Original strand, 44671208 - 44671364
Alignment:
| Q |
98 |
gggtttcaactgatgtgtagctgcaattgaaaatcttgaaactatcttcgatggaaaaaggcaatggctgttgcttctctaatttatcttcaattgccac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44671208 |
gggtttcaactgatgtgtagctgcaattgaaaatcttgaaactatcttcgatggaaaaaggcaatggctgttgcttctctagtttatcttcaattgccac |
44671307 |
T |
 |
| Q |
198 |
cctttcaagtgtggcttttgttgtcatcttgatcttggttcgtgatgtccatctcat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
44671308 |
cctttcaagtgtggcttttgttgtcatcttgatcttggttcgtgttgttcatgtcat |
44671364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 44671175 - 44671070
Alignment:
| Q |
1 |
tttactgctagcttttccttttcaggaccaacaacacacctctctcactgcacaaacaaacaatattataagtctataacaaatgaggatgctagagggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671175 |
tttactgctagcttttccttttcaggaccaacaacacacctctctcactgcacaaacaaacaatattataagtctataacaaatgaggatgctagagggg |
44671076 |
T |
 |
| Q |
101 |
tttcaa |
106 |
Q |
| |
|
|||||| |
|
|
| T |
44671075 |
tttcaa |
44671070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University