View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_46 (Length: 223)
Name: NF0707_2D_low_46
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_2D_low_46 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 45 - 223
Target Start/End: Complemental strand, 2756137 - 2755959
Alignment:
| Q |
45 |
tcatgtgttttgactattgtttttggaggattaaatgtgagtatctaatttatatgctttttactaaacaaattgtgtttgttaaaagatcttcgttttt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756137 |
tcatgtgttttgactattgtttttggaggattaaatgtgagtatctaattcatatgctttttactaaacaaattgtgtttgttaaaagatcttcgttttt |
2756038 |
T |
|
| Q |
145 |
aattagtattgtcgttgttaatagattcgtcggtggaagcgctgggaagactcaattgttgcagatgaaaacaatcaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756037 |
aattagtattgtcgttgttaatagattcgtcggtggaagcgctgggaagactcaattgttgcagatgaaaacaatcaat |
2755959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 48 - 216
Target Start/End: Complemental strand, 2748095 - 2747922
Alignment:
| Q |
48 |
tgtgttttgactattgtttttggaggattaaatgtgagtatctaattta----tatgctttttacta-aacaaattgtgtttgttaaaagatcttcgttt |
142 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||| || ||| ||||||| || ||||||||||||| || |||| ||||| || |
|
|
| T |
2748095 |
tgtgttttgactattatttttggaggactaaatgtgagtatctaatctaatcatatactttttattataacaaattgtgttcgtgaaaaactcttcttta |
2747996 |
T |
|
| Q |
143 |
ttaattagtattgtcgttgttaatagattcgtcggtggaagcgctgggaagactcaattgttgcagatgaaaac |
216 |
Q |
| |
|
||||| ||||| | || |||||||||||||||| ||||||| ||||||| | || |||||||||||||||||| |
|
|
| T |
2747995 |
ttaataagtatcattgtcgttaatagattcgtcgatggaagccctgggaaaattctattgttgcagatgaaaac |
2747922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1641 times since January 2019
Visitors: 4426