View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_50 (Length: 216)
Name: NF0707_2D_low_50
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_2D_low_50 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 36 - 216
Target Start/End: Original strand, 16790618 - 16790798
Alignment:
Q |
36 |
gataaaatatctgatgaacaaggaatgtgtaggttgcgagaggctattttgaaaatttatttgtataaaatgatagcactcgtacaccagttatagatgc |
135 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
16790618 |
gataaaatatctgatgaacaaggaatgtgtaggttgcgagaggctattttgaaaatttatttgtataaaataatagcactcgtacaccagttatagatgc |
16790717 |
T |
 |
Q |
136 |
tatttcgactgtgatcacagaggatgataatgctcttttaacaaccccctttcaacctcaagaatatgttttctatgcacc |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16790718 |
tatttcgactgtgatcacagaggatgataatgctcttttaacaaccccctttcaacctcaagaatatgttttctatgcacc |
16790798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 36 - 177
Target Start/End: Complemental strand, 20155778 - 20155636
Alignment:
Q |
36 |
gataaaatatctgatgaacaaggaatgtgt-aggttgcgagaggctattttgaaaatttatttgtataaaatgatagcactcgtacaccagttatagatg |
134 |
Q |
|
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| |||| ||||||||||||||| |
|
|
T |
20155778 |
gataaaatatctgatgaacatggaatgtgtcaggttgcgagaggctattttaaaaatttatttgtacaaaataatagcgttcgttcaccagttatagatg |
20155679 |
T |
 |
Q |
135 |
ctatttcgactgtgatcacagaggatgataatgctcttttaac |
177 |
Q |
|
|
||||||| || ||||||||| ||||||||||| ||||||||| |
|
|
T |
20155678 |
ctatttcaaccgtgatcacataggatgataataatcttttaac |
20155636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 862 times since January 2019
Visitors: 4397