View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_52 (Length: 215)
Name: NF0707_2D_low_52
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_2D_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 79 - 197
Target Start/End: Original strand, 7166946 - 7167064
Alignment:
Q |
79 |
ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7166946 |
ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa |
7167045 |
T |
 |
Q |
179 |
cagtttcggccatagaacc |
197 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
7167046 |
cagtttcggccatagaacc |
7167064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 81 - 185
Target Start/End: Original strand, 7160310 - 7160414
Alignment:
Q |
81 |
acctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaaca |
180 |
Q |
|
|
|||||||||||| || || |||||||| |||| |||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||| |
|
|
T |
7160310 |
acctgggtcgcgcacggtggctcgaactgtgtagccgcgctccataagtctcataacaagccacgacccgatgaaacctgaagcccctgtgacgcaaact |
7160409 |
T |
 |
Q |
181 |
gtttc |
185 |
Q |
|
|
||||| |
|
|
T |
7160410 |
gtttc |
7160414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 7166871 - 7166922
Alignment:
Q |
7 |
tggtgttaaaatatgaattgatttatacatgatatgaaaaatgttgcaacat |
58 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7166871 |
tggtgttaaaatatgaattgatttatacatgatatgaaaaatgttgcaacat |
7166922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University