View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_55 (Length: 213)
Name: NF0707_2D_low_55
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_2D_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 13871953 - 13871754
Alignment:
| Q |
1 |
ccagtgaaccctagacagggtagttgaagtagtcgtcgccaccaccatggtcgacttacatgagtctaactttgtttttcgttttgtggcggtgctttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13871953 |
ccagtgaaccctagacagggtagttgaagtagtcgtcgctatcaccatggtcgacttacatgagtctaactttgtttttcgttttgtggcggtgcttcat |
13871854 |
T |
|
| Q |
101 |
gtttttgatctggtccaattggagttcaaaatgatgaattgtgtcacattcaacccgttaggatttcccttcacttcgtgtttgtggtggtgatgtccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13871853 |
gtttttgatctggtccaattggagtttgaaatgatgaattgtgtcacattcaacccgttagggtttcccttcacttcatgtttgtggtggtggtgtccat |
13871754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1661 times since January 2019
Visitors: 4426