View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_57 (Length: 207)
Name: NF0707_2D_low_57
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_2D_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 43986100 - 43985953
Alignment:
Q |
1 |
aaagcaggaaacaaaacatgccctaaaacaggggagaatattaaaaacacagagttagtcccaaacacaacgctgaagagacttatccaacaattttgca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43986100 |
aaagcaggaaacaaaacatgccctaaaacaggggagaatattaaaaacacagagttagtcccaaacacaacgctgaagagacttatccaacaattttgca |
43986001 |
T |
 |
Q |
101 |
gtgataatggtatttcattcacaagattttctaaccgtaaccgtgaca |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43986000 |
gtgataatggtatttcattcacaagattttctaaccgtaaccgtgaca |
43985953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 139 - 207
Target Start/End: Original strand, 43985889 - 43985957
Alignment:
Q |
139 |
aaccgtgacagaaactgcgtagcatgtgctgctgcagaactaccgggtaaaatcgtcctcgttatgtca |
207 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43985889 |
aaccatgacagaaactgcgtagcatgtgctgctgcagaactaccgggtaaaatcgtcctcgttatgtca |
43985957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University