View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_59 (Length: 201)
Name: NF0707_2D_low_59
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_2D_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 43985786 - 43985604
Alignment:
Q |
1 |
gattgaagttggaactgtgccaccactgttggatcttttagctacggaggataaaaccactcaggagaatgcaatctctgctttactgaagctttcaaag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43985786 |
gattgaagttggaactgtgccaccactgttggatcttttagctacggaggataaaaccactcaggagaatgcaatctctgctttactgaagctttcaaag |
43985687 |
T |
 |
Q |
101 |
tatgcaaccgggcctgaaaatataatagaccataacggtttaaatcccgttgtgtatgtactgaaaaatggacttagtcttga |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
43985686 |
tatgcaaccgggcctgaaaatataatagaccataacggtttaaagcccgttgtgtatgtactgaaaaatggacttagtcttga |
43985604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University