View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_2D_low_6 (Length: 545)
Name: NF0707_2D_low_6
Description: NF0707_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_2D_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 503; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 503; E-Value: 0
Query Start/End: Original strand, 1 - 527
Target Start/End: Complemental strand, 43985627 - 43985101
Alignment:
| Q |
1 |
actgaaaaatggacttagtcttgaagcccgtcaaattgcagctgctataatattctatctttgttcagtgaaagaatatagaaaattaataggtgaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985627 |
actgaaaaatggacttagtcttgaagcccgtcaaattgcagcagctataatattctatctttgttcagtgaaagaatatagaaaattaataggtgaaaat |
43985528 |
T |
 |
| Q |
101 |
caagatgtgattcatggtttagttgaattggctaaagaaggaacaacctgcgggaaaaagaatgcagtggttgccatttttggacttcttttgcttccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43985527 |
caagatgtgattcatggtttagttgaattggctaaagaaggaacaacctgcggaaaaaagaatgcagtggttgcgatttttggacttcttttgcttccta |
43985428 |
T |
 |
| Q |
201 |
ggaatcatcaacgtgtgcttgaagccggtgctgttcacgcgcttgtttctattttgaataccttgtgcaacaaggaagagcttgttactgaaactttggc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43985427 |
ggaatcatcaacgtgtgcttgaagccggtgctgttcacgcgcttgtttctattttgaataccttgtgcaacaaggaagagcttgttactgaaactctggc |
43985328 |
T |
 |
| Q |
301 |
tgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgccgttgattgctgggctgttgcgatctgctccttcg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43985327 |
tgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcattgccgttgattactgggctgttgcgatctgctccttcg |
43985228 |
T |
 |
| Q |
401 |
cgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgtggatgttgctggtgttcttgctaaggatgttacacttatgc |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985227 |
cgtgctgcaaaggaacattgtgtttcgatattgttgtctctatgtgttaatggtggtgttgatgttgctggtgttcttgctaaggatgttacacttatgc |
43985128 |
T |
 |
| Q |
501 |
ctttgctctattcgcttcttactgatg |
527 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43985127 |
ctttgctctattcgcttcttactgatg |
43985101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 23 - 100
Target Start/End: Complemental strand, 35205912 - 35205835
Alignment:
| Q |
23 |
gaagcccgtcaaattgcagctgctataatattctatctttgttcagtgaaagaatatagaaaattaataggtgaaaat |
100 |
Q |
| |
|
|||||||||| | ||||||||| ||||||||| || || |||||||||||| || |||||||||||||| |||||| |
|
|
| T |
35205912 |
gaagcccgtcgagttgcagctggtataatattttacctcacttcagtgaaagagtacagaaaattaataggcgaaaat |
35205835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University