View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_high_24 (Length: 257)
Name: NF0707_high_24
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 222
Target Start/End: Original strand, 24211222 - 24211423
Alignment:
| Q |
22 |
atgatcgaatttgtcaatatttaatgttaatttggtcattgatgctttgatggacccaattattcaaatcatctctaactttatatttcacannnnnnna |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211222 |
atgatcgaatttgtcaatatttaatgttaatttggtcattgatgctttgatggacccaattattcaaatcatctctaactttatatttcacatttttttt |
24211321 |
T |
|
| Q |
122 |
-aagtattttgttgcatcaacttcattatcaacaagtttagtaacgttgtgtttaataaagttctctttataatcaacagagacctcattatcgtttggt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24211322 |
gaagtattttgttgcatcaacttcattatcaacaagtttagtaacgttgtgcttaataaagttctctttataatcaacagagacctcattatcgtttggt |
24211421 |
T |
|
| Q |
221 |
tt |
222 |
Q |
| |
|
|| |
|
|
| T |
24211422 |
tt |
24211423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 24206037 - 24206098
Alignment:
| Q |
136 |
atcaacttcattatcaacaagtttagtaacgttgtgtttaataaagttctctttataatcaa |
197 |
Q |
| |
|
||||||||||| || ||||||||||| ||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
24206037 |
atcaacttcatcataaacaagtttagaaacaatgtgcttaataatgttctctttataatcaa |
24206098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 385 times since January 2019
Visitors: 4381