View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_high_25 (Length: 257)
Name: NF0707_high_25
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_high_25 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 174 - 257
Target Start/End: Complemental strand, 6844749 - 6844666
Alignment:
Q |
174 |
catgtggtagaacaatttttgtcaaactttacttatcttcggttcaaacttcgaattatcaagacatatttttgctgagggtta |
257 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
T |
6844749 |
catgtggtagaacaacttttgtcaaactttacttatcttcggttcgaacttcagattatcaagacatatttttgctgagggtta |
6844666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 29 - 108
Target Start/End: Complemental strand, 6844893 - 6844815
Alignment:
Q |
29 |
tcttacactattgctataataacttttccaataacaagttatttttataagtttttctactattcttggtttagaattac |
108 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
T |
6844893 |
tcttacactattgctataataacttttcca-taacaagttatttttataagtttttctactattcttattttggaattac |
6844815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 507 times since January 2019
Visitors: 4385