View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_high_36 (Length: 204)
Name: NF0707_high_36
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 107 - 186
Target Start/End: Complemental strand, 43544178 - 43544099
Alignment:
| Q |
107 |
gcctctcccaccacgccccgaatcatactttctatcccttgcgtgaccgttgccgaatctagggccaaaaccaccgccgc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43544178 |
gcctctcccaccacgccccgaatcatactttctatcacttgcgtgaccgttgccgaatctagggccaaaaccaccaccgc |
43544099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1590 times since January 2019
Visitors: 4425