View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_high_5 (Length: 426)
Name: NF0707_high_5
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 150 - 414
Target Start/End: Original strand, 9546349 - 9546616
Alignment:
| Q |
150 |
gttgttgttcatactgatcatcttgatgttgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagnnnnnn |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546349 |
gttgttgttcatactgatcatcttgatgctgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagaaaaaa |
9546448 |
T |
 |
| Q |
250 |
ngctacttcttcttcagttgttatatccgatgaagaactcagtacagaaacagactcattctgtactgagtttttcaccggatc---atctttcttgacc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9546449 |
agctacttcttcttcagttgttatatccgatgaagaactcagtacagaaaaagactcgttctgtactgagtttttcaccggatcattatctttcttgacc |
9546548 |
T |
 |
| Q |
347 |
cgtttggatcgtggaccagttggattctttgatgattcagtttcactttctctatcttcctgaagaat |
414 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
9546549 |
cgtttggatcgtggtccagttggattctttgacgactcagtttcacttcctctatcttcctgaagaat |
9546616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 7 - 38
Target Start/End: Complemental strand, 15239352 - 15239321
Alignment:
| Q |
7 |
ctaatgttgtgatgtttgttttgagtgcttct |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15239352 |
ctaatgttgtgatgtttgttttgagtgcttct |
15239321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University