View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_high_9 (Length: 405)
Name: NF0707_high_9
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 5e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 110 - 242
Target Start/End: Complemental strand, 9546232 - 9546100
Alignment:
Q |
110 |
gtacgaggaagatacaaatgcgacacgtgtaacaaagtgtttcgttcatatcaagcactaggtggacacagagcgagtcacaagaaaaataaacaagttg |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9546232 |
gtacgaggaagatacaaatgcgacacgtgtaacaaagtgtttcgttcatatcaagcactaggtggacacagagcgagtcacaagaaaaataaacaagttg |
9546133 |
T |
 |
Q |
210 |
cagaaagtggtggtgattattcaatttcacaac |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
9546132 |
cagaaagtggtggtgattattcaatttcacaac |
9546100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 345 - 383
Target Start/End: Original strand, 4996576 - 4996614
Alignment:
Q |
345 |
gttcatcattgattgcacacttttctccataataatccc |
383 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4996576 |
gttcatcattgattgcacacttttctccataataatccc |
4996614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 936 times since January 2019
Visitors: 4397