View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_16 (Length: 479)
Name: NF0707_low_16
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 122 - 393
Target Start/End: Original strand, 42117308 - 42117579
Alignment:
| Q |
122 |
ttatgtcatgtaatgttgggctcatagatagctaataggtacaagttatgggttgctctgctatcacaatttatccacttattcttcttcccttcatcct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117308 |
ttatgtcatgtaatgttgggctcatagatagctaataggtacaagtaatgggttgctctgctatcacaatttatccacttattcttcttcccttcatcct |
42117407 |
T |
|
| Q |
222 |
gtttatctcaacctctcatcttcaaaggtgaaccaacaaagctgcaaactctttaaaccaagccatatatgattaggtcgatctcctctacatcaattat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117408 |
gtttatctcaacctctcatcttcaaaggtgaaccaacaaagctgcaaactctttaaaccaagccatatatgattaggtcgatctcctctacatcaattat |
42117507 |
T |
|
| Q |
322 |
agtcttcaatgctttagaccttgtctcttcttcactatataagcctcttttacataacatgaacaaaacaaa |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42117508 |
agtcttcaatgctttagaccttgtctcttcttcactatataagcctcttttacataacatgaacaaaacaaa |
42117579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1007 times since January 2019
Visitors: 4400