View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_37 (Length: 307)
Name: NF0707_low_37
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 30 - 222
Target Start/End: Complemental strand, 10772590 - 10772395
Alignment:
| Q |
30 |
tatacttcctgaaatctccaaggaatacgttgttagaataaaacaaaa--tcagagtttttaaaatttttggaatttcgcaatcatattttttacaaatt |
127 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||| || ||| | |||||||||||||||||||||| |
|
|
| T |
10772590 |
tatacttcctgaaatccccaaggaatacgttgttagaataaaaaaaaaaatcagagtttttaaaatttctgaaatattgcaatcatattttttacaaatt |
10772491 |
T |
 |
| Q |
128 |
tccagagcataaatcattgaaactttattaaac-aaaatcctaagaatatgtttggatgactaaatttaaataggtaacacaatttttcagggaat |
222 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10772490 |
tcccgagcataaatcattgaaactttattaaacaaaaatcttaagaatatgtttggatgaataaatttaaataggtaacacaatttttcagggaat |
10772395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 303
Target Start/End: Complemental strand, 10772027 - 10771994
Alignment:
| Q |
270 |
atttttaacaatttgttgattatattattcgaca |
303 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
10772027 |
atttttaacaatttgttgattatattagtcgaca |
10771994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University