View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_38 (Length: 292)
Name: NF0707_low_38
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 34 - 282
Target Start/End: Complemental strand, 32092623 - 32092375
Alignment:
Q |
34 |
tcatcttcaagtaaacaaattttcttccctttacactattattttacactgtcnnnnnnncagcatttaactgccctattttggtataaataattggttg |
133 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32092623 |
tcatcttcaagtaaacaaattttcttccctttacactattattttacactgtctttttttcagcatttaactgccctattttggtataaataattggttg |
32092524 |
T |
 |
Q |
134 |
catcatatttctataaacaacttaatattacataaaaatcttgtatttatcataaataaaatttatgattatttataaagagataatcacaataccaaat |
233 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32092523 |
catcatatttctataaacaacttaatattacataaaaatcttgtatttatcataaatgaaatttatgattatttataaagagataatcacaataccaaat |
32092424 |
T |
 |
Q |
234 |
cattataatctttaacattcattattgtttagttattgttagtcctttg |
282 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32092423 |
cattataatctttaacattcattattgtttagttattgttagtcctttg |
32092375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1529 times since January 2019
Visitors: 4422