View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_42 (Length: 266)
Name: NF0707_low_42
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 39 - 146
Target Start/End: Original strand, 9976796 - 9976902
Alignment:
Q |
39 |
agtatggtgctctctatttctgttatgaaatggagaaatctcaactcttattttacactttgtattaatgaaaaataaaataaaactgggtgagtaggtc |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
9976796 |
agtatggtgctctctatttctgttatgaaatgaagaaatctcaactcttattttacac-ttgtattaatgaaaaataaaataaaactgagtgagtaggtc |
9976894 |
T |
 |
Q |
139 |
aatgaaaa |
146 |
Q |
|
|
|||||||| |
|
|
T |
9976895 |
aatgaaaa |
9976902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University