View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_45 (Length: 258)
Name: NF0707_low_45
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_low_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 9979053 - 9978825
Alignment:
| Q |
30 |
agaagtttatgaaaggggtccacaaaatcatccaagacagcttaggatgaggatggtggctaataattccttccttcaattcaatcaaatcaaatataaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9979053 |
agaagtttatgaaaggggtccacaaaatcatccaagacagcttaggatgaggatggtggctaataattccttccttcaattcaatcaaatcaaatataaa |
9978954 |
T |
 |
| Q |
130 |
taaatgtcaaacatatacatgtgggacggaccaaaccaatagattcagctcttggttcttattcacttaattgtccaatttgtgagagttnnnnnnncat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9978953 |
taaatgtcaaacatatacatgtgggacggaccaaaccaatagattcagctcttggttcttattcacttaattgtccaatttgtgagagttaaaaaaacat |
9978854 |
T |
 |
| Q |
230 |
tacatgtggtggcgtatcataattttaga |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9978853 |
tacatgtggtggcgtatcataattttaga |
9978825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University