View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_low_45 (Length: 258)

Name: NF0707_low_45
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_low_45
NF0707_low_45
[»] chr5 (1 HSPs)
chr5 (30-258)||(9978825-9979053)


Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 258
Target Start/End: Complemental strand, 9979053 - 9978825
Alignment:
30 agaagtttatgaaaggggtccacaaaatcatccaagacagcttaggatgaggatggtggctaataattccttccttcaattcaatcaaatcaaatataaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9979053 agaagtttatgaaaggggtccacaaaatcatccaagacagcttaggatgaggatggtggctaataattccttccttcaattcaatcaaatcaaatataaa 9978954  T
130 taaatgtcaaacatatacatgtgggacggaccaaaccaatagattcagctcttggttcttattcacttaattgtccaatttgtgagagttnnnnnnncat 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||    
9978953 taaatgtcaaacatatacatgtgggacggaccaaaccaatagattcagctcttggttcttattcacttaattgtccaatttgtgagagttaaaaaaacat 9978854  T
230 tacatgtggtggcgtatcataattttaga 258  Q
    |||||||||||||||||||||||||||||    
9978853 tacatgtggtggcgtatcataattttaga 9978825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1739 times since January 2019
Visitors: 4429