View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_48 (Length: 256)
Name: NF0707_low_48
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 39545823 - 39545722
Alignment:
Q |
30 |
tgtatctgacggtataaaatacttgctcataataagagattagtgacactctctcaccggagacaccgtcttagaatattgaaactatatgcatatccct |
129 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
T |
39545823 |
tgtatccgacggtataaaatacttgctcataataagagattagtgacactctctcaccggagacagcgtcttagaatattgaaactatatgcatatctct |
39545724 |
T |
 |
Q |
130 |
at |
131 |
Q |
|
|
|| |
|
|
T |
39545723 |
at |
39545722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 169 - 240
Target Start/End: Complemental strand, 39545685 - 39545614
Alignment:
Q |
169 |
tgagcactaaagagaataacgaacttcaacaaatgacgaatcgtttaagataacataagtgtatttatctgt |
240 |
Q |
|
|
||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
T |
39545685 |
tgagccctaaagagaatgacgaacttcaacaaatgatgaatcgtttaagataacataagtttatttatctgt |
39545614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University