View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_low_48 (Length: 256)

Name: NF0707_low_48
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_low_48
NF0707_low_48
[»] chr5 (2 HSPs)
chr5 (30-131)||(39545722-39545823)
chr5 (169-240)||(39545614-39545685)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 39545823 - 39545722
Alignment:
30 tgtatctgacggtataaaatacttgctcataataagagattagtgacactctctcaccggagacaccgtcttagaatattgaaactatatgcatatccct 129  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||    
39545823 tgtatccgacggtataaaatacttgctcataataagagattagtgacactctctcaccggagacagcgtcttagaatattgaaactatatgcatatctct 39545724  T
130 at 131  Q
    ||    
39545723 at 39545722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 169 - 240
Target Start/End: Complemental strand, 39545685 - 39545614
Alignment:
169 tgagcactaaagagaataacgaacttcaacaaatgacgaatcgtttaagataacataagtgtatttatctgt 240  Q
    ||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||    
39545685 tgagccctaaagagaatgacgaacttcaacaaatgatgaatcgtttaagataacataagtttatttatctgt 39545614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University