View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_53 (Length: 251)
Name: NF0707_low_53
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_low_53 |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 9526530 - 9526287
Alignment:
| Q |
1 |
atataggtacagggctgttacaagtgcatactatagaggtgcattaggagccatgctagtatatgacataaccaaaagacaatcatttgatcatgttgct |
100 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
9526530 |
atataggtacagagctgtaacaagtgcatactatagaggtgcattaggagcaatgctagtatatgacataaccaaaaggcaatcttttgatcatgttgct |
9526431 |
T |
 |
| Q |
101 |
aaatgggttgaggaacttagagcacatgcagataactcaattgtgatcatgctagttggtaacaaaggtgaccttgttgacttgagaatggttcctactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
9526430 |
aaatgggttgaggaacttagagcacatgcagataactcaattgtgatcatgctagttggtaacaaaggtgaccttgttgatttgagaatggtccctactg |
9526331 |
T |
 |
| Q |
201 |
aagatgcagttgagtttgcagaagaccaaggtttattcatctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9526330 |
aagatgcagttgagtttgcagaagaccaaggtttattcttctca |
9526287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 48932172 - 48932348
Alignment:
| Q |
1 |
atataggtacagggctgttacaagtgcatactatagaggtgcattaggagccatgctagtatatgacataaccaaaagacaatcatttgatcatgttgct |
100 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| ||||||||| | ||||||||||| ||| |
|
|
| T |
48932172 |
atataggtacagagcggttacaagtgcatactacagaggagcattaggggccatgctggtgtatgacataactaaaagacaaacgtttgatcatgtagct |
48932271 |
T |
 |
| Q |
101 |
aaatgggttgaggaacttagagcacatgcagataactcaattgtgatcatgctagttggtaacaaaggtgaccttgt |
177 |
Q |
| |
|
| |||| |||||||||| | |||| || || ||||| || |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
48932272 |
agatggattgaggaactacggtcacacgccgacaactccatcgtgatcatgctaattggtaacaaaggtgatcttgt |
48932348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 93
Target Start/End: Original strand, 14388 - 14479
Alignment:
| Q |
2 |
tataggtacagggctgttacaagtgcatactatagaggtgcattaggagccatgctagtatatgacataaccaaaagacaatcatttgatca |
93 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| |||||||| | || || ||| |||| || ||||| || ||| | |||||||| ||||| |
|
|
| T |
14388 |
tataggtacagggcagttactagtgcatactatcgaggtgcagttggggcaatgttagtttacgacatgacaaaacgtcaatcattcgatca |
14479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University