View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_62 (Length: 236)
Name: NF0707_low_62
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0707_low_62 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 43544171 - 43544129
Alignment:
Q |
194 |
ccactacgccccgaatcatactttctatcacttgcgtgaccgt |
236 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
43544171 |
ccaccacgccccgaatcatactttctatcacttgcgtgaccgt |
43544129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1309 times since January 2019
Visitors: 4413