View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_63 (Length: 233)
Name: NF0707_low_63
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 8683475 - 8683616
Alignment:
| Q |
1 |
tctacatgtttgtttgaatttcctagaggtttactatgacaatgagagggattcaaggtgctttgatcataagttcaagtttccaaatggctattggann |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8683475 |
tctacatgtttgtttgaatttcctagaggtttactatgacaatgagagggattcaaggtgctttgatcataagttcaagtttccaaatggctattggatt |
8683574 |
T |
|
| Q |
101 |
nnnnnnnnnnnggagaaatgctgtcaggttagtatctgtaac |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8683575 |
ttttggtttttggagaaatgctgtcaggttagtatctgtaac |
8683616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 842 times since January 2019
Visitors: 4393