View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0707_low_71 (Length: 206)

Name: NF0707_low_71
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0707_low_71
NF0707_low_71
[»] chr4 (1 HSPs)
chr4 (104-188)||(43544099-43544183)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 104 - 188
Target Start/End: Complemental strand, 43544183 - 43544099
Alignment:
104 ccaccgcctctcccaccacgccccgaatcatactttctatcacttgcgtgaccgttgccgaatctagggccaaaaccaccgccgc 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
43544183 ccaccgcctctcccaccacgccccgaatcatactttctatcacttgcgtgaccgttgccgaatctagggccaaaaccaccaccgc 43544099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1025 times since January 2019
Visitors: 4400