View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0707_low_74 (Length: 204)
Name: NF0707_low_74
Description: NF0707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0707_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 126 - 186
Target Start/End: Complemental strand, 43544159 - 43544099
Alignment:
| Q |
126 |
gaatcatactttctatcccttgcgtgaccgttgccgaatctagggccaaaaccaccgccgc |
186 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43544159 |
gaatcatactttctatcacttgcgtgaccgttgccgaatctagggccaaaaccaccaccgc |
43544099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 271 times since January 2019
Visitors: 4374