View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_high_16 (Length: 250)
Name: NF0708_high_16
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 35288751 - 35288974
Alignment:
| Q |
16 |
atgatgtcttaatccaacatnnnnnnngggcgtcttcaaagaaatcaagccgaaaaagcagcacaagatcaaggaatgaaacaatgggtacagattcagc |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
35288751 |
atgatgtcttaatccaacatcaaaaaagggcgtcttcaaagaaatcaagccgaaaaagtagcacaagatcaaggaatgtaacaatgagtacagattcagc |
35288850 |
T |
 |
| Q |
116 |
agagggaagtgcttcttccagtgaccaaaaaagtagaaaatggaagagctttgttggtaatttaagccacacgacaaacagcacaaaaaaggctgttatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
35288851 |
agagggaagtgcttcttccagtgaccaaaaaagtagaaaatggaagagctttgttggtaatttaagccaaaagacaaacagcacaaaaaaggctgttatc |
35288950 |
T |
 |
| Q |
216 |
aaagaattaagcatgacgagcagc |
239 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
35288951 |
aaagaattaagcatgaagagcagc |
35288974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University