View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_high_17 (Length: 230)
Name: NF0708_high_17
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 64 - 219
Target Start/End: Original strand, 31784832 - 31784987
Alignment:
| Q |
64 |
gagaaggagcagagacaaacagatgatgaaaactttgaacatgtcgaaactgagaaccaaaacctttggttgcaagatttgaataatcaggttgatgaaa |
163 |
Q |
| |
|
||||| || |||| ||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31784832 |
gagaatgaacagaaacagacagatgatggaaactttgaacatgtctcaactgagaaccaaaacctttggttgcaagatttgtataatcaggttgatgaaa |
31784931 |
T |
|
| Q |
164 |
cagttgtttttaaaccatatgattttgattcccttgatgatagagtgttgaaattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31784932 |
cagttgtttttaaaccatatgattttgattcccttgatgatagagtgttgaaattg |
31784987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University