View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_high_19 (Length: 213)
Name: NF0708_high_19
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 29 - 110
Target Start/End: Complemental strand, 13643953 - 13643872
Alignment:
| Q |
29 |
aaacgcagcttcaattgattctacgatgtggtttcagcaattaaatacgattttggtttggcccagatcctggtttcagaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13643953 |
aaacgcagcttcaattgattctacgatgtggtttcagcaattaaataccattttggtttggcccagatcctggtttcagaac |
13643872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University