View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_high_3 (Length: 358)
Name: NF0708_high_3
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 32 - 295
Target Start/End: Complemental strand, 2468028 - 2467765
Alignment:
| Q |
32 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacaaagtcatcctcggaagcacgaacgaatccctatacgaaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468028 |
atcatcagaagacacattctgtgttgccaattggcattgagaatcggaattttcggcaacagagtcatcctcggaagcacgaacgaatccctatacgaaa |
2467929 |
T |
 |
| Q |
132 |
atgaaaataaatttgaggcattgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagcccgaaaaatgttggtgaattgaaagcg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2467928 |
atgaaaataaatttgaggcattgaattgaatgaaatgaagttgaagataggttcaggaaattaccgttgtagaccgaaaaatgttggtgaattgaaagcg |
2467829 |
T |
 |
| Q |
232 |
tggtggtaatttgagattgcagcgaggagtaggaggggggaaaatggaagaggatataagtgag |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2467828 |
tggtggtaatttgagattgcagcgaggagtaggagggggaaaaatggaagaggatataagtgag |
2467765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University