View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_high_4 (Length: 342)
Name: NF0708_high_4
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 80 - 192
Target Start/End: Original strand, 36877455 - 36877568
Alignment:
| Q |
80 |
gatttcatccaaaattttctgatatgca-taattatattatatagcatgtagtagtctatgtatatatgctttaatctttaaattaaaatttgattaagc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36877455 |
gatttcatccaaaattttctgatatgcaataattatattatatagcatgcagtagtctatgtatatatgctttaatctttaaattgaaatttgattaagc |
36877554 |
T |
 |
| Q |
179 |
tgattgaaaactag |
192 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36877555 |
tgattgaaaactag |
36877568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 36877660 - 36877717
Alignment:
| Q |
281 |
ctgtatgccatctttgaatggcagttttaagctattaactatgattttggaaatattg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36877660 |
ctgtatgccatctttgaatggcagttttaagctattaactatgattttggaaatattg |
36877717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 69
Target Start/End: Complemental strand, 36876056 - 36876027
Alignment:
| Q |
40 |
caatacatttctttctgaatgttgtttttt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36876056 |
caatacatttctttctgaatgttgtttttt |
36876027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 338
Target Start/End: Complemental strand, 15046859 - 15046814
Alignment:
| Q |
293 |
tttgaatggcagttttaagctattaactatgattttggaaatattg |
338 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
15046859 |
tttgaatggcagtttcaagctattagctaaaattttggaaatattg |
15046814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 40 - 68
Target Start/End: Original strand, 17881510 - 17881538
Alignment:
| Q |
40 |
caatacatttctttctgaatgttgttttt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17881510 |
caatacatttctttctgaatgttgttttt |
17881538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University