View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_low_13 (Length: 324)
Name: NF0708_low_13
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0708_low_13 |
 |  |
|
[»] scaffold0294 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 78 - 215
Target Start/End: Complemental strand, 5380637 - 5380503
Alignment:
Q |
78 |
agcaaaggcagcagcaccacgaagagcctctctccatttcggcgacttatctttcttcttcttcttcgaaagtttgctcaagagactctcaaacgcttgt |
177 |
Q |
|
|
||||||||||||||| ||| |||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
T |
5380637 |
agcaaaggcagcagccccatgaagagcctctctccatttcagcgtcttatctttcttcttcttc---gaaagtttgctcaagagactttcaaaagcttgt |
5380541 |
T |
 |
Q |
178 |
ccaaactcaccagtttggtgacgtacctcggagggatc |
215 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| |
|
|
T |
5380540 |
ccaaactcaccagtttggtgacgtacctccaagggatc |
5380503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 203
Target Start/End: Complemental strand, 5174359 - 5174292
Alignment:
Q |
136 |
ttcttcttcgaaagtttgctcaagagactctcaaacgcttgtccaaactcaccagtttggtgacgtac |
203 |
Q |
|
|
|||||||| |||| | ||||||||||||| | ||||||| |||||||||||| |||||||| ||||| |
|
|
T |
5174359 |
ttcttctttgaaattctgctcaagagactttggaacgcttttccaaactcacctgtttggtgtcgtac |
5174292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 136 - 203
Target Start/End: Complemental strand, 5276105 - 5276038
Alignment:
Q |
136 |
ttcttcttcgaaagtttgctcaagagactctcaaacgcttgtccaaactcaccagtttggtgacgtac |
203 |
Q |
|
|
|||||||| |||| | ||||||||||||| | ||||||| |||||||||||| |||||||| ||||| |
|
|
T |
5276105 |
ttcttctttgaaattctgctcaagagactttggaacgcttttccaaactcacctgtttggtgtcgtac |
5276038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 203
Target Start/End: Original strand, 5692812 - 5692878
Alignment:
Q |
137 |
tcttcttcgaaagtttgctcaagagactctcaaacgcttgtccaaactcaccagtttggtgacgtac |
203 |
Q |
|
|
||||||| |||| | ||||||||||||| | ||||||| |||||||||||| |||||||| ||||| |
|
|
T |
5692812 |
tcttctttgaaattctgctcaagagactttggaacgcttttccaaactcacctgtttggtgtcgtac |
5692878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 80 - 131
Target Start/End: Original strand, 11770 - 11821
Alignment:
Q |
80 |
caaaggcagcagcaccacgaagagcctctctccatttcggcgacttatcttt |
131 |
Q |
|
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11770 |
caaagccagtagcaccacgaagagcctctctccatttcggcgacttatcttt |
11821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University