View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_low_20 (Length: 300)
Name: NF0708_low_20
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 33 - 273
Target Start/End: Complemental strand, 29296059 - 29295819
Alignment:
| Q |
33 |
cctcgctcatcattaccctaacgcattcgctttcaagctcgcgaaacttctagaaactcaccctaaactcgagatccgaaacgaagctgtttcgattctt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29296059 |
cctcgctcatcattaccctaacgcattcgctttcaagctcgcgaaacttctagaaactcaccctaaactcgagatccgaaacgaagctgtttcgattctt |
29295960 |
T |
 |
| Q |
133 |
cttcacattttcaaaaaatctgataaatggaatcctagtatgcttaatcaactcaaagaacctcttcttaattcgctcaagaaagaatatagtgaatctc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29295959 |
cttcacattttcaaaaaatctgataaatggaatcctagtatgcttaatcaactcaaagaacctcttattaattcgctcaagaaagaatatagtgaatctc |
29295860 |
T |
 |
| Q |
233 |
tttttcaacctctctgtgaaacgatcggtctctgtgctgct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29295859 |
tttttcaacctctctgtgaaacgatcggtctttgtgctgct |
29295819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 87
Target Start/End: Complemental strand, 29333507 - 29333455
Alignment:
| Q |
35 |
tcgctcatcattaccctaacgcattcgctttcaagctcgcgaaacttctagaa |
87 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || || || || ||||||||| |
|
|
| T |
29333507 |
tcgcacatcattaccctaacgcattcgctttgaaacttgcaaagcttctagaa |
29333455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University