View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_low_26 (Length: 261)
Name: NF0708_low_26
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 99 - 260
Target Start/End: Complemental strand, 19755701 - 19755540
Alignment:
| Q |
99 |
ctttgtacattttttaatgcttggcttttgtctactccagattgttttcttggaattgtgctcagatcgtcaggaagtgcttttgcatgacaacatggag |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755701 |
ctttgaacattttttaatgcttggcttttgtctactccagattgttttcttggaattgtgctcagatcgtcaggaagtgcttttgcatgacaacatggag |
19755602 |
T |
|
| Q |
199 |
gtttccactcttttagttcatattttagataatgcaatcatgacaattaggggtagcttttc |
260 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19755601 |
gtttccactattttagttcatatttcagataatgcaatcatgacaattaggtgtagcttttc |
19755540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University