View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_low_33 (Length: 230)
Name: NF0708_low_33
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 6232927 - 6232712
Alignment:
| Q |
1 |
gttgcccaacattctcgtattcgagaacggaaacattaagatttcagatttcggccttgcgaaagagataggtgtagaacaaggtgaaaagtggcaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6232927 |
gttgcccaacattctcgtattcgagaacggaaacattaagatttcagatttcgggcttgcgaaagagacaggtgtagaacaaggtgaaaagtggcaaccg |
6232828 |
T |
 |
| Q |
101 |
agaggaactccgatgattatgtcaccagaagcagtgaatgatagtgtttatgaatcgccagccgatatatgggctcttggttgcgccgtcgtggagatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232827 |
agaggaactccgatgattatgtcaccagaagcagtgaatgatagtgtgtatgaatcgtcagccgatatatgggctcttggttgcgccgtcgtggagatga |
6232728 |
T |
 |
| Q |
201 |
ttaccggagaacccgc |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6232727 |
ttaccggagaacccgc |
6232712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 36 - 199
Target Start/End: Complemental strand, 6222116 - 6221953
Alignment:
| Q |
36 |
ttaagatttcagatttcggccttgcgaaagagataggtgtagaacaaggtgaaaagtggcaaccgagaggaactccgatgattatgtcaccagaagcagt |
135 |
Q |
| |
|
|||||||||| ||||| |||||||| || |||| |||| || |||| |||| ||| | | || || |||||||| || ||||||||||||||| || |
|
|
| T |
6222116 |
ttaagatttcggattttggccttgctaaggagaaaggtctaaaacatggtggaaaattggaatgtaggggaactccattgtatatgtcaccagaagcggt |
6222017 |
T |
 |
| Q |
136 |
gaatgatagtgtttatgaatcgccagccgatatatgggctcttggttgcgccgtcgtggagatg |
199 |
Q |
| |
|
||| || |||||||||||||| || || ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
6222016 |
gaacgagagtgtttatgaatcaccggcagatatatgggctcttggttgcgctattgtggagatg |
6221953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University