View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_low_35 (Length: 218)
Name: NF0708_low_35
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 43601975 - 43601883
Alignment:
| Q |
1 |
actgcaaattattgtcaagtggaactgttttcagagacaactttatcatgtgcggggctgtgtcttggtgcagaaataattttcataatttga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43601975 |
actgcaaattattgtcaagtggaactgttttcagagacaactttatcatgtgcggggctgtgttttggtgcagaaataattttcataatttga |
43601883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 22436242 - 22436329
Alignment:
| Q |
4 |
gcaaattattgtcaagtggaactgttttcagagacaactttatcatgtgcggggctgtgtcttggtgcagaaataattttcataattt |
91 |
Q |
| |
|
||||||||||||||| |||||| ||| | |||| ||||||||||||||||||| | ||| ||||||||||||| ||||||||||||| |
|
|
| T |
22436242 |
gcaaattattgtcaattggaaccgttataagaggcaactttatcatgtgcgggagtatgttttggtgcagaaatcattttcataattt |
22436329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 91
Target Start/End: Original strand, 22239084 - 22239124
Alignment:
| Q |
51 |
tgcggggctgtgtcttggtgcagaaataattttcataattt |
91 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
22239084 |
tgcgggactgtgttttggtgcagaaataattttcataattt |
22239124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 91
Target Start/End: Original strand, 37560602 - 37560642
Alignment:
| Q |
51 |
tgcggggctgtgtcttggtgcagaaataattttcataattt |
91 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
37560602 |
tgcgggactgtgttttggtgcagaaataattttcataattt |
37560642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University