View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0708_low_7 (Length: 367)
Name: NF0708_low_7
Description: NF0708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0708_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 101 - 290
Target Start/End: Complemental strand, 39092722 - 39092532
Alignment:
| Q |
101 |
caaatcaagctcaatacactctccaactcctagcactattgagtttagattttagtgtgtgaataatgttgcaggtggcccaacaataggt-agactcta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39092722 |
caaatcaagctcaatacactctccaactcctagcactattgagtttagattttagtgtgtgaataatgttgcaggtggcccaacaataggttagactcta |
39092623 |
T |
 |
| Q |
200 |
ataccatattaaatttttatattaggagacagtgcatataaattgaccattaaactctaagtaagaataaatgcagaaaagatagtactct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092622 |
ataccatattaaatttttatattaggagacagtgcatataaattgaccattaaactctaagtaagaataaatgcagaaaagatagtactct |
39092532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 191 - 221
Target Start/End: Original strand, 37872681 - 37872711
Alignment:
| Q |
191 |
tagactctaataccatattaaatttttatat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37872681 |
tagactctaataccatattaaatttttatat |
37872711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University