View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0709_low_10 (Length: 255)
Name: NF0709_low_10
Description: NF0709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0709_low_10 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 44693967 - 44693737
Alignment:
| Q |
29 |
aaaaagaaccctgaaatgcaagcaaaccttcagattctgagggacaaaattgtgtactctcctctcgatatttttatttatttagcaagcatttttcttt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44693967 |
aaaaagaaccctgaaatgcaagcaaaccttcagattctgagggacaaaattgtgtactctcctctcgatatttttatttgcttagcaagcatttttcttt |
44693868 |
T |
 |
| Q |
129 |
tgtgcaaaaacgtgaggtacaaaaccatataacatactgaagcagggttacactactaaactcacaaacctaacccatcagagaac----gagtattcaa |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44693867 |
tgtgcaaaaatgtgaggtacaaaaccatataacatactgaagcagggttacactactaaactcacaaacctaacccatcagagaacaagtgagtattcaa |
44693768 |
T |
 |
| Q |
225 |
acactacagttgaagcgttatgttcactctt |
255 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
44693767 |
acactacagttgaagtgttatgttcactctt |
44693737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 44633928 - 44633877
Alignment:
| Q |
29 |
aaaaagaaccctgaaatgcaagcaaaccttcagattctgagggacaaaattgt |
81 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
44633928 |
aaaaagaacactggaatgcaagcaaaccttcatattc-gagggacaaaattgt |
44633877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 61
Target Start/End: Complemental strand, 44693636 - 44693604
Alignment:
| Q |
29 |
aaaaagaaccctgaaatgcaagcaaaccttcag |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44693636 |
aaaaagaaccctgaaatgcaagcaaaccttcag |
44693604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 255
Target Start/End: Complemental strand, 5013623 - 5013582
Alignment:
| Q |
215 |
gagtattcaaacacta-cagttgaagcgttatgttcactctt |
255 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
5013623 |
gagtattcaaacactaacagttgaagtgttatgttcactctt |
5013582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University