View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0709_low_13 (Length: 219)

Name: NF0709_low_13
Description: NF0709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0709_low_13
NF0709_low_13
[»] chr7 (1 HSPs)
chr7 (1-133)||(18352819-18352951)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 18352819 - 18352951
Alignment:
1 tgtgaaggatcctaattatggtggttagaaagaactaagaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18352819 tgtgaaggatcctaattatggtggttagaaagaactatgaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct 18352918  T
101 tacgagtaatgccagctgataacactcatttta 133  Q
    ||||||||||||||| | || ||||||||||||    
18352919 tacgagtaatgccagttaatgacactcatttta 18352951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University