View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0709_low_8 (Length: 268)
Name: NF0709_low_8
Description: NF0709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0709_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 41 - 237
Target Start/End: Original strand, 32183229 - 32183421
Alignment:
Q |
41 |
caaatattagtagttagttgttagattagnnnnnnnncttctttatccaggtttgaacgttgtgatcaatttcacatagataattaatctacaatggcta |
140 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
T |
32183229 |
caaatattagtagttagttgttagattagttttttttcttctttatccgggtttgaacgttgtgatcaatttcacatagataat----ctacaatagcta |
32183324 |
T |
 |
Q |
141 |
aagaaagttgttcctttgcaggaactaagtggaagtaaattgcaagctgattcaaattctataccactagttttccatgaggtacacatcttccctt |
237 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32183325 |
aagaaagttgttcctttgcaggaactaagtggaagtaaattgcaagctgattcaaattctataccactagttttccatgaggtacacatcttccctt |
32183421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 840 times since January 2019
Visitors: 4356