View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0710_high_10 (Length: 319)
Name: NF0710_high_10
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0710_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 25 - 306
Target Start/End: Original strand, 44166658 - 44166939
Alignment:
| Q |
25 |
atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166658 |
atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa |
44166757 |
T |
|
| Q |
125 |
tcccagatctgtgctcctccaaagtatcaactaacaaatgtttcttatctcctttatttttcttccaaaccttaannnnnnnatctgttgatccggtgta |
224 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44166758 |
tcccagatctgtgcttctccaaagtatcaactaacaaatgtttcttatctcctttatttttcttccaaaccttaatttttttatctgttgatccggtgta |
44166857 |
T |
|
| Q |
225 |
aacatatccatcgttagaaactgtgattgcgtttattgcatcgtcgtgtgcgttttgcactgattccaaacatgtcaagtct |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44166858 |
aacatatccatcgttagaaactgtgattgcgtttattgcatcgtcgtgtgcgttttgcaatgattccaaacatgtcaagtct |
44166939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 316 times since January 2019
Visitors: 4379