View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0710_high_14 (Length: 258)
Name: NF0710_high_14
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0710_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 24 - 165
Target Start/End: Original strand, 8294116 - 8294257
Alignment:
Q |
24 |
atcaaaagaaacttatacttattttaatacactagtgtttgcaacttgcaatgattctgcagtggctcgttgaaatgaaaacggatgagatggnnnnnnn |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8294116 |
atcaaaagaaacttatacttattttaatacactaatgtttgcaacttgcaatgattctgcagtggctcgttgaaatgaaaacggatgagatggaaaaaaa |
8294215 |
T |
 |
Q |
124 |
caacacattgataaatctacctgttgatgtgttggaattgat |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8294216 |
caacacattgataaatctacctgttgatgtgttggaattgat |
8294257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University